\
You have a function that you want to maximise/minimise. The parameters in your function may be bounded (must lie in a specific interval) or not. The cogent optimisers can be applied to these cases. The Powell (a local optimiser) and SimulatedAnnealing (a global optimiser) classes in particular have had their interfaces standardised for such use cases. We demonstrate for a very simple function below.
We write a simple factory function that uses a provided value for omega to compute the squared deviation from an estimate.
>>> import numpy
>>> def DiffOmega(omega):
... def omega_from_S(S):
... omega_est = S/(1-numpy.e**(-1*S))
... return abs(omega-omega_est)**2
... return omega_from_S
We then import the Powell optimiser, create our optimisable function with a value of omega to solve for S and instantiate an optimiser instance. Note that we provide lower and upper bounds and an initial guess for our parameter of interest (S).
>>> from cogent.maths.optimisers import Powell
>>> omega = 0.1
>>> opt = Powell(DiffOmega(omega),
... xinit=[1.0], # the vector of initial values
... bounds=([-100], [100]), # [(lower),(upper)] bounds for the params
... direction=-1) # -1 is minimise func, 1 is maximise
We then optimise the function, obtaining the fit statistic and the associated estimate of S.
>>> fit, vec = opt.run()
>>> assert 0.0 <= fit < 1e-6
>>> print 'S=%.4f' % vec[0]
S=-3.6150
To be written.
Basic identity function to avoid having to test explicitly for None
>>> from cogent.util.misc import identity
>>> my_var = None
>>> if identity(my_var):
... print "foo"
... else:
... print "bar"
...
bar
Convenience function for performing one-line if/else statements. This is similar to the C-style tertiary operator:
>>> from cogent.util.misc import if_
>>> result = if_(4 > 5, "Expression is True", "Expression is False")
>>> result
'Expression is False'
However, the value returned is evaluated, but not called. For instance:
>>> from cogent.util.misc import if_
>>> def foo():
... print "in foo"
...
>>> def bar():
... print "in bar"
...
>>> if_(4 > 5, foo, bar)
<function bar at...
This support method will force a variable to be an iterable, allowing you to guarantee that the variable will be safe for use in, say, a for loop.
>>> from cogent.util.misc import iterable
>>> my_var = 10
>>> for i in my_var:
... print "will not work"
...
Traceback (most recent call last):
TypeError: 'int' object is not iterable
>>> for i in iterable(my_var):
... print i
...
10
To determine the index of the largest item in any iterable container, use max_index:
>>> from cogent.util.misc import max_index
>>> l = [5,4,2,2,6,8,0,10,0,5]
>>> max_index(l)
7
Note
Will return the lowest index of duplicate max values
To determine the index of the smallest item in any iterable container, use min_index:
>>> from cogent.util.misc import min_index
>>> l = [5,4,2,2,6,8,0,10,0,5]
>>> min_index(l)
6
Note
Will return the lowest index of duplicate min values
To flatten a 2-dimensional list, you can use flatten:
>>> from cogent.util.misc import flatten
>>> l = ['abcd','efgh','ijkl']
>>> flatten(l)
['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l']
Conversion of a nested tuple into a list can be performed using deep_list:
>>> from cogent.util.misc import deep_list
>>> t = ((1,2),(3,4),(5,6))
>>> deep_list(t)
[[1, 2], [3, 4], [5, 6]]
Simply calling list will not convert the nested items:
>>> list(t)
[(1, 2), (3, 4), (5, 6)]
Conversion of a nested list into a tuple can be performed using deep_list:
>>> from cogent.util.misc import deep_tuple
>>> l = [[1,2],[3,4],[5,6]]
>>> deep_tuple(l)
((1, 2), (3, 4), (5, 6))
Simply calling tuple will not convert the nested items:
>>> tuple(l)
([1, 2], [3, 4], [5, 6])
Same as: min <= number <= max, although it is quickly readable within code
>>> from cogent.util.misc import between
>>> between((3,5),4)
True
>>> between((3,5),6)
False
Combinate returns all k-combinations of items. For instance:
>>> from cogent.util.misc import combinate
>>> list(combinate([1,2,3],0))
[[]]
>>> list(combinate([1,2,3],1))
[[1], [2], [3]]
>>> list(combinate([1,2,3],2))
[[1, 2], [1, 3], [2, 3]]
>>> list(combinate([1,2,3],3))
[[1, 2, 3]]
These handy methods will cPickle an object and automagically gzip the file. You can also then reload the object at a later date.
>>> from cogent.util.misc import gzip_dump, gzip_load
>>> class foo(object):
... some_var = 5
...
>>> bar = foo()
>>> bar.some_var = 10
>>> # gzip_dump(bar, 'test_file')
>>> # new_bar = gzip_load('test_file')
>>> # isinstance(new_bar, foo)
Note
The above code does work, but cPickle won’t write out within doctest
curry(f,x)(y) = f(x,y) or = lambda y: f(x,y). This was modified from the Python Cookbook. Docstrings are also carried over.
>>> from cogent.util.misc import curry
>>> def foo(x,y):
... """Some function"""
... return x + y
...
>>> bar = curry(foo, 5)
>>> print bar.__doc__
curry(foo,5)
== curried from foo ==
Some function
>>> bar(10)
15
Perform a simple test to see if an object supports iteration
>>> from cogent.util.misc import is_iterable
>>> can_iter = [1,2,3,4]
>>> cannot_iter = 1.234
>>> is_iterable(can_iter)
True
>>> is_iterable(cannot_iter)
False
Perform a simple test to see if an object is a single character
>>> from cogent.util.misc import is_char
>>> class foo:
... pass
...
>>> is_char('a')
True
>>> is_char('ab')
False
>>> is_char(foo())
False
To flatten a deeply nested iterable, use recursive_flatten. This method supports multiple levels of nesting, and multiple iterable types
>>> from cogent.util.misc import recursive_flatten
>>> l = [[[[1,2], 'abcde'], [5,6]], [7,8], [9,10]]
>>> recursive_flatten(l)
[1, 2, 'a', 'b', 'c', 'd', 'e', 5, 6, 7, 8, 9, 10]
Perform a simple check to see if an object is not a list or a tuple
>>> from cogent.util.misc import not_list_tuple
>>> not_list_tuple(1)
True
>>> not_list_tuple([1])
False
>>> not_list_tuple('ab')
True
Unflatten an iterable of items to a specified row-width. This does reverse the effect of zip as the lists produced are not interleaved.
>>> from cogent.util.misc import unflatten
>>> l = [1,2,3,4,5,6,7,8]
>>> unflatten(l,1)
[[1], [2], [3], [4], [5], [6], [7], [8]]
>>> unflatten(l,2)
[[1, 2], [3, 4], [5, 6], [7, 8]]
>>> unflatten(l,3)
[[1, 2, 3], [4, 5, 6]]
>>> unflatten(l,4)
[[1, 2, 3, 4], [5, 6, 7, 8]]
Reverse the effects of a zip method, i.e. produces separate lists from tuples
>>> from cogent.util.misc import unzip
>>> l = ((1,2),(3,4),(5,6))
>>> unzip(l)
[[1, 3, 5], [2, 4, 6]]
Select items in a specified order
>>> from cogent.util.misc import select
>>> select('ea', {'a':1,'b':5,'c':2,'d':4,'e':6})
[6, 1]
>>> select([0,4,8], 'abcdefghijklm')
['a', 'e', 'i']
Obtain the indices for items in sort order. This is similar to numpy.argsort, but will work on any iterable that implements the necessary cmp methods
>>> from cogent.util.misc import sort_order
>>> sort_order([4,2,3,5,7,8])
[1, 2, 0, 3, 4, 5]
>>> sort_order('dcba')
[3, 2, 1, 0]
Find all of the overlapping occurrences of a pattern within a text
>>> from cogent.util.misc import find_all
>>> text = 'aaaaaaa'
>>> pattern = 'aa'
>>> find_all(text, pattern)
[0, 1, 2, 3, 4, 5]
>>> text = 'abababab'
>>> pattern = 'aba'
>>> find_all(text, pattern)
[0, 2, 4]
Find all of the overlapping occurrences of multiple patterns within a text. Returned indices are sorted, each index is the start position of one of the patterns
>>> from cogent.util.misc import find_many
>>> text = 'abababcabab'
>>> patterns = ['ab','abc']
>>> find_many(text, patterns)
[0, 2, 4, 4, 7, 9]
‘Unreserve’ a mutation of Python reserved words
>>> from cogent.util.misc import unreserve
>>> unreserve('class_')
'class'
>>> unreserve('class')
'class'
Create a case-insensitive object, for instance, if you want the key ‘a’ and ‘A’ to point to the same item in a dict
>>> from cogent.util.misc import add_lowercase
>>> d = {'A':5,'B':6,'C':7,'foo':8,42:'life'}
>>> add_lowercase(d)
{'A': 5, 'a': 5, 'C': 7, 'B': 6, 42: 'life', 'c': 7, 'b': 6, 'foo': 8}
Extract data from a line that is surrounded by different right/left delimiters
>>> from cogent.util.misc import extract_delimited
>>> line = "abc[def]ghi"
>>> extract_delimited(line,'[',']')
'def'
Get a dictionary with the values set as keys and the keys set as values
>>> from cogent.util.misc import InverseDict
>>> d = {'some_key':1,'some_key_2':2}
>>> InverseDict(d)
{1: 'some_key', 2: 'some_key_2'}
Note
An arbitrary key will be set if there are multiple keys with the same value
Get a dictionary with the values set as keys and the keys set as values. Can handle the case where multiple keys point to the same values
>>> from cogent.util.misc import InverseDictMulti
>>> d = {'some_key':1,'some_key_2':1}
>>> InverseDictMulti(d)
{1: ['some_key_2', 'some_key']}
>>>
DictFromPos returns the positions of all items seen within a sequence. This is useful for obtaining, for instance, nucleotide counts and positions
>>> from cogent.util.misc import DictFromPos
>>> seq = 'aattggttggaaggccgccgttagacg'
>>> DictFromPos(seq)
{'a': [0, 1, 10, 11, 22, 24], 'c': [14, 15, 17, 18, 25], 't': [2, 3, 6, 7, 20, 21], 'g': [4, 5, 8, 9, 12, 13, 16, 19, 23, 26]}
DictFromFirst will return the first location of each item in a sequence
>>> from cogent.util.misc import DictFromFirst
>>> seq = 'aattggttggaaggccgccgttagacg'
>>> DictFromFirst(seq)
{'a': 0, 'c': 14, 't': 2, 'g': 4}
DictFromLast will return the last location of each item in a sequence
>>> from cogent.util.misc import DictFromLast
>>> seq = 'aattggttggaaggccgccgttagacg'
>>> DictFromLast(seq)
{'a': 24, 'c': 25, 't': 21, 'g': 26}
Automatically construct a distance matrix lookup function. This is useful for maintaining flexibility about whether a function is being computed or if a lookup is being used
>>> from cogent.util.misc import DistanceFromMatrix
>>> from numpy import array
>>> m = array([[1,2,3],[4,5,6],[7,8,9]])
>>> f = DistanceFromMatrix(m)
>>> f(0,0)
1
>>> f(1,2)
6
Get all of the pairs of items present in a list of groups. A key will be created (i,j) iff i and j share a group
>>> from cogent.util.misc import PairsFromGroups
>>> groups = ['ab','xyz']
>>> PairsFromGroups(groups)
{('a', 'a'): None, ('b', 'b'): None, ('b', 'a'): None, ('x', 'y'): None, ('z', 'x'): None, ('y', 'y'): None, ('x', 'x'): None, ('y', 'x'): None, ('z', 'y'): None, ('x', 'z'): None, ('a', 'b'): None, ('y', 'z'): None, ('z', 'z'): None}
Check an object against base classes or derived classes to see if it is acceptable
>>> from cogent.util.misc import ClassChecker
>>> class not_okay(object):
... pass
...
>>> no = not_okay()
>>> class okay(object):
... pass
...
>>> o = okay()
>>> class my_dict(dict):
... pass
...
>>> md = my_dict()
>>> cc = ClassChecker(str, okay, dict)
>>> o in cc
True
>>> no in cc
False
>>> 5 in cc
False
>>> {'a':5} in cc
True
>>> 'asasas' in cc
True
>>> md in cc
True
Delegate object method calls, properties and variables to the appropriate object. Useful to combine multiple objects together while assuring that the calls will go to the correct object.
>>> from cogent.util.misc import Delegator
>>> class ListAndString(list, Delegator):
... def __init__(self, items, string):
... Delegator.__init__(self, string)
... for i in items:
... self.append(i)
...
>>> ls = ListAndString([1,2,3], 'ab_cd')
>>> len(ls)
3
>>> ls[0]
1
>>> ls.upper()
'AB_CD'
>>> ls.split('_')
['ab', 'cd']
Wrap a function to hide it from a class so that it isn’t a method.
>>> from cogent.util.misc import FunctionWrapper
>>> f = FunctionWrapper(str)
>>> f
<cogent.util.misc.FunctionWrapper object at ...
>>> f(123)
'123'
Wrap a container with a constraint. This is useful for enforcing that the data contained is valid within a defined context. PyCogent provides a base ConstrainedContainer which can be used to construct user-defined constrained objects. PyCogent also provides ConstrainedString, ConstrainedList, and ConstrainedDict. These provided types fully cover the builtin types while staying integrated with the ConstrainedContainer.
Here is a light example of the ConstrainedDict
>>> from cogent.util.misc import ConstrainedDict
>>> d = ConstrainedDict({'a':1,'b':2,'c':3}, Constraint='abc')
>>> d
{'a': 1, 'c': 3, 'b': 2}
>>> d['d'] = 5
Traceback (most recent call last):
ConstraintError: Item 'd' not in constraint 'abc'
PyCogent also provides mapped constrained containers for each of the default types provided, MappedString, MappedList, and MappedDict. These behave the same, except that they map a mask onto __contains__ and __getitem__
>>> def mask(x):
... return str(int(x) + 3)
...
>>> from cogent.util.misc import MappedString
>>> s = MappedString('12345', Constraint='45678', Mask=mask)
>>> s
'45678'
>>> s + '123'
'45678456'
>>> s + '9'
Traceback (most recent call last):
ConstraintError: Sequence '9' doesn't meet constraint
Determine if an application is available on a system
>>> from cogent.util.misc import app_path
>>> app_path('ls')
'/bin/ls'
>>> app_path('does_not_exist')
False